The DFCI Lotus japonicus Gene Index (LjGI)
l_japonicus EST Search: Ljirnpest38-077-d5

GB#s are linked to GenBank accessions. Clone End describes which end of the cDNA was sequenced. Cat# links to a report for the library from which this EST was derived. TC# links to the TC which contains this EST. Low quality, vector and polyA/T regions (trimmed from the EST) are shown in gray 

>Ljirnpest38-077-d5 BG662067 LP077-38-d5
GAATTCGGCACCAGGGGAAAATGGCCTCCTCTATGATTTCCTCCCCTGCTGTTACCACTG
TTAACCATGCCAACATGGTTGCCCCATTCACTGGTCTCAAATCCATGGCTGGTTTCCCAG
TTACAAGAAAGGCCAACAATGACATCACCTCCATTGCAAGCAATGGTGGAAGAGTCAACT
GCATGCAGGTGTGGCCTCCAATTGGCAAGAAGAAGTTTGAGACCCTTTCTTACCTTCCAC
CACTCACCGTGGAGCAATTGGCAAAGGAAGTAGAATACCTTATCA
EST IDGB #CloneClone EndCat #TC#Linked EST
Ljirnpest38-077-d5 BG662067 LP077-38-d5 5' #28A TC44987 n/a
Tentative Annotation:
(from TC44987):   similar to UniRef100_Q39832 Cluster: Ribulose-1,5-bisphosphate carboxylase small subunit precursor; n=1; Glycine max|Rep: Ribulose-1,5-bisphosphate carboxylase small subunit precursor - Glycine max (Soybean), partial (98%) 0

Comments and suggestions : Contact Us

Acknowledgements
   The Gene Index Project is supported in part by funding from the US National Science Foundation through grant #DBI-0552416.