The DFCI Arabidopsis thaliana Gene Index (AtGI)
AtGI TC Report:
EST IDs are linked to AtGI EST reports. ET# s are linked to qcGene reports. GB#s are linked to GenBank accessions.

>TC308959 TC49039 TC53366 TC64499 TC75118 TC100247 TC127760 TC150055 TC184733
ATTTTCTCACCGTCGAGAGAACAAAACACAAGTTGCAGACTTTATCCAAATTTAGGGTTTTCTTTTTCTTCTTACTCAGA
TTATCATCAGATCTTCGAAACCCCAAATTTACAAATCAGATCAGCTTCCCGGTTAGTACTACCCTCAAATCAACTAAGTT
TCATGTCTGAACTTGACTCCCAGGTTCCCACTGCCTTTGATCCGTTTGCTGATGCGAATGTTGAGGACTCAGGTGCCGGA
ACAAAAGAATACGTTCATATCCGTGTCCAGCAGCGAAATGGTAGGAAAAGCTTGACAACCGTCCAGGGCCTGAAGAAAGA
GTACAGCTATACCAAGATACTTAAGGACCTCAAAAAAGAGTTTTGCTGCAACGGCACTGTGGTTCAGGATTCAGAACTCG
GACAGGTTATACAGCTTCAAGGTGACCAACGTAAGAACGTCTCCACATTCCTTGTCCAGGCTGGTTTGGTGAAGAAGGAT
AACATCAAGATCCATGGTTTCTAAGCTATCTAGTGGATCATATTATTAATAAAACCATATCTTTTTCTTTCATCTCTTGT
TGCGAATTTCGGGTTTGATTCATCAAAATCGTCTTCTTCCTAGTGTTCTTCTTCTGTTTGGTATTCGAATTTTAATGGCT
TATGTTCACCATACTTCTTCCCCTGTTTTCGTGTTACTCTGTTTCACATCTTACTTATCTTATAATATCAGTTTGTTAAG
ATAAA
1=============================Open Reading Frames============================725

                   ======================================                         +1
                                                                                  +2
 ===================                                                              +3
                                            ============                          -3
                                                                                  -2
                                                                                  -1
                   ======================================                         ESTScan(+)
                                                                                  
                   ======================================                         framefinder(+)
________________________________________________________________________________
1===================================TC308959=================================725
                         1                          >                 65       >
                            2                            >
                            3                            >
                         4                         >
                       5                        >    <            64            
                         6                          >
                             7                             >
                          8                          >
                          9                           >
                    10a                    >                  61               >
.                                     10b                                      >
                 11                  >            <             62             
                         12                        >
      13     >  <                              44                               
                        14                        >
                     15                     >      <            63             
                         16                        >
                           17                           >
                           18                           >
                     19                     >
                     20                     >
                    21                    >
                     22                     >
                       23                      >
                  24                >   <                  58                  
                       25                     >
                 26                >    <                  59                   
                         27                       >
                              28                           >
                           29                         >
                            30                          >
                             31                          >
                          32                        >
                 33               >     <                 60                  
                            34                         >
                          35                        >
                                    36                              >
                     37             >
                         38                  >
                                   39                           >
         <                                40                                
                                    41                           >
                                       42                              >
                                  43                          >
                                   45                  >
                                   46                  >
                      <                           47                            
                                                  48                           >
                         <                       49                        
                          <                         50                         
                            <                       51                        
                            <                        52                        
                             <                       53                        
                              <                       54                       
                                <                   55                   
                                   <                     56                     
                                    <                    57                     

                                                                                                                                                             
 #  Src  EST Id              GB#           Clone/Protein   left  right Library/Protein name
                                                                                                                                                             
 1  I034 1104117             DR217311      249483              1   477 CERES-148
 2  I034 65891               DR217315      31642               1   524 CERES-147
 3  I034 129703              DR217317      97484               1   527 CERES-147
 4  I034 954427              DR217326      151170              1   467 CERES-148
 5  I034 168832              DR217327      148891              1   444 CERES-148
 6  I034 160106              DR217334      142705              1   477 CERES-148
 7  I034 111197              DR217340      91890               1   546 CERES-147
 8  I034 1141993             DR217319      263368              2   488 CERES-147
 9  I034 960669              DR217320      158520              2   494 CERES-148
10a I034 73450               DR217324      39319               2   400 CERES-148
10b I034 146881              DR376421      39319              11   725 CERES-148
11  I034 1082004             DR217330      232364              2   342 CERES-148
12  I034 4519150             DR217323      1024981             9   470 CERES-149
13  I034 1147295             DR217329      268670              9   125 CERES-147
14  I034 152475              DR217335      119515              9   462 CERES-149
15  I034 43801               DR217314      9071               12   412 CERES-147
16  I034 158883              DR217322      126577             12   471 CERES-148
17  I034 151076              DR217328      118089             12   516 CERES-148
18  I034 960728              DR217336      158579             12   521 CERES-148
19  I034 155447              DR217338      122575             12   406 CERES-148
20  I024 BP823889            BP823889      RAFL22-07-N19      13   405 RAFL19
21  I024 BP842248            BP842248      RAFL21-54-C10      13   392 RAFL21
22  I024 BP863379            BP863379      RAFL21-66-H17      13   409 RAFL21
23  I034 57639               DR217337      23212              15   436 CERES-147
24  I008 119                 T04169        2A8T7P             20   331 Lambda-PRL2
25  I008 33755               AA728701      K5A1TP             21   424 CD4-6
26  I008 33771               AA728717      K6A1TP             21   329 CD4-6
27  I034 58765               DR217309      24365              26   458 CERES-147
28  I006 AV554105            AV554105      RZ81b01R           28   540 Arabidopsis thaliana roots Columbia
29  I034 115060              DR217313      95182              28   502 CERES-147
30  I034 1140673             DR217331      262048             28   519 CERES-147
31  I034 44314               DR217339      9592               28   527 CERES-147
32  I034 4523912             DR217310      1029011            30   483 CERES-149
33  I034 1146897             DR217318      268272             30   321 CERES-147
34  I034 151139              DR217325      118153             30   504 CERES-148
35  I034 49734               DR217332      15110              30   478 CERES-149
36  I02A 63-E018429-019-008  CB254660      MPIZp768N158Q      50   621 MPIZ-ADIS-019
37  I006 AV552875            AV552875      RZ47f08R           74   339 Arabidopsis thaliana roots Columbia
38  I034 12844731            DR217312      1367511            74   415 CERES-AN65
39  I034 1106431             DR217333      251797             74   593 CERES-147
40  I006 AV544550            AV544550      RZ47f08F           81   691 Arabidopsis thaliana roots Columbia
41  I02A 82-E018440-019-009  CB253952      MPIZp768D229Q      81   599 MPIZ-ADIS-019
42  I02A 48-E012740-027-002  CB257046      MPIZp772P122Q      81   653 MPIZ-ADIS-027
43  I034 129706              DR217316      97487              83   570 CERES-147
44  I006 AV522344            AV522344      APZ77e11F         145   722 Arabidopsis thaliana aboveground organs two to six-week old
45  ETG  NP231840            AB005232      BAB08755          163   504 protein translation factor Sui1 homolog
46  ETG  NP646168            BT005836      AAO64771          163   504 At5g54760 [Arabidopsis thaliana]
47  I006 AV562201            AV562201      SQ165g10F         196   722 Arabidopsis thaliana green siliques Columbia
48  I034 12823674            DR217321      1359436           219   722 CERES-AN65
49  I002 701552423           AI997154      701552423         227   683 A. thaliana, Columbia Col-0, root-2
50  I024 BP578328            BP578328      RAFL14-17-J22     236   717 RAFL14
51  I006 AV564318            AV564318      SQ202e12F         250   709 Arabidopsis thaliana green siliques Columbia
52  I024 BP581541            BP581541      RAFL14-32-F23     258   717 RAFL14
53  I024 BP576117            BP576117      RAFL14-15-J10     259   717 RAFL14
54  I024 BP583054            BP583054      RAFL14-39-F08     273   717 RAFL14
55  I024 BP634831            BP634831      RAFL17-36-B04     286   661 RAFL17
56  I024 BP671389            BP671389      RAFL21-39-K12     321   722 RAFL21
57  I02B 01L18               CD529119                        323   722 Arabidopsis Leaf Senescence Library
58  I024 BP654132            BP654132      RAFL19-16-H15     359   717 RAFL19
59  I006 AV545363            AV545363      RZ81b01F          360   722 Arabidopsis thaliana roots Columbia
60  I006 AV557954            AV557954      SQ085c01F         360   707 Arabidopsis thaliana green siliques Columbia
61  I006 AV549113            AV549113      RZ03e05R          422   722 Arabidopsis thaliana roots Columbia
62  I024 BP582767            BP582767      RAFL14-37-P05     452   717 RAFL14
63  I024 AU226938            AU226938      RAFL14-68-A02     460   714 RAFL14
64  I006 AV558445            AV558445      SQ098g11F         484   722 Arabidopsis thaliana green siliques Columbia
65  I024 BP810750            BP810750      RAFL24-27-F15     575   722 RAFL16



Sequence source codes:

I006 Kazusa DNA Research Institute, The First Laboratory for Plant Gene Research
I02A Max Planck Institute for Plant Breeding Research, ADIS DNA core facility at MPIZ
I002 Genome Systems  Inc.  a wholly owned subsidiary of Incyte Pharmaceuticals  Inc.,  
I008 Michigan State University, Dept. of Biochemistry & Molecular Biology
I034 Ceres  Inc, 
I02B Cornell University, Department of Horticulture
I024 RIKEN Genomic Sciences Center, Plant Functional Genomics Research Group
ETGB Expressed Transcripts from GenBank

TC sequence strand: coding strand

Evidence for coding strandEvidence for reverse complement Inconclusive evidence
ESTs5' ESTs (used as +) 39 (used as -) - (5'/3' source not known)
3' ESTs (used as -) 17 (used as +) 1
total56 1 7
Expressed transcripts1 -  
Predicted genes1 -
Protein hits3 -
Trimmed polyA/T2 -

Tentative Annotation:
UP|Q9FFV1_ARATH (Q9FFV1) Protein translation factor Sui1 homolog (At5g54760), complete 0


Clone links to other TCs:
EST Orientation Linked EST Linked EST Orientation Linked TC #
DR376421 3' DR301512 5' TC302551
DR217324 5' DR301512 5' TC302551


GO annotation

GO idGO termEC#TypeGOpep link%sim%cov
GO:0003743translation initiation factor activity-MGeneDB_Spombe|SPBC23G7.05 8075
GO:0005840ribosome-CGeneDB_Spombe|SPBC23G7.05 8075
GO:0008372cellular component unknown-CTAIR|gene:1005027740 8879
GO:0006413translational initiation-BGeneDB_Spombe|SPBC23G7.05 8075


Referenced by :
Tentative Ortholog Group 1012950 (general group)
Tentative Ortholog Group 1038031 (general group)
Tentative Ortholog Group 1038032 (general group)
Tentative Ortholog Group 1040238 (general group)
Tentative Ortholog Group 1093739 (general group)
Tentative Ortholog Group 967382 (general group)
Tentative Ortholog Group 977372 (general group)

Maps to :
GenomeChromosomeEnd5End3ScoreShow genomic alignment with:
Arabidopsis genome chr5 22,261,093 22,262,964 681    

Comments and suggestions : Contact Us

Acknowledgements
   The Gene Index Project is supported in part by funding from the US National Science Foundation through grant #DBI-0552416.