The Gene Index Project

**The DFCI Arabidopsis thaliana Gene Index (AtGI)**

AtGI TC Report:

EST IDs are linked to AtGI EST reports. ET# s are linked to qcGene reports. GB#s are linked to GenBank accessions.

>TC284366 TC3821 TC143677 TC160730 TC183400
TCTACCTCAATTTATATTATTTGCTTCAATCTTCTCTTTATCGCTCCACCAGATCCAAGTTCGCGAGATTTCAAGCTCTC
TAACAAAGTTCTTCACTTTTGCTCTCAAAGCTTTCATCTTTCATTCAACTACTTAAGCTCCAAGTATGGCAGGATCCGCA
CCGGAAGGAACACAATTTGATACGCGTCAGTTTGACCAGAGGCTGAATGAAGTTCTCGATGGACAGGATGAGTTCTTCAC
CTCATATGATGAGGTCCATGAGAGCTTTGATGCCATGGGTTTGCAAGAGAATCTTCTTAGGGGTATCTATGCTTACGGTT
TCGAAAAGCCTTCTGCTATTCAGCAAAGAGGAATTGTACCCTTTTGCAAGGGTCTTGATGTGATCCAGCAGGCACAGTCT
GGTACTGGAAAAACCGCCACTTTCTGCTCTGGTGTCTTGCAGCAGCTTGACTATGCCCTTCTCCAGTGCCAGGCTCTCGT
TTTGGCTCCCACCAGAGAGCTTGCTCAGCAGATTGAGAAGGTCATGCGTGCCCTTGGTGACTACCAAGGTGTCAAGGTTC
ATGCCTGTGTTGGTGGAACCAGTGTCCGTGAGGATCAGCGCATTCTCCAGGCTGGTGTTCATGTTGTCGTTGGAACTCCC
GGTCGTGTTTTTGACATGCTTAGAAGACAATCTCTCCGCCCTGACTGCATCAAGATGTTTGTCCTTGATGAAGCTGATGA
AATGCTCTCCCGTGGTTTCAAGGATCAGATCTATGACATATTCCAGCTTCTCCCACCAAAGATTCAGGTTGGAGTGTTCT
CTGCGACAATGCCTCCGGAAGCTTTGGAGATCACAAGAAAATTCATGAGCAAACCAGTGAGAATCTTGGTGAAACGTGAT
GAGCTCACACTTGAAGGTATCAAGCAATTCTACGTGAACGTGGAGAAAGAAGACTGGAAGCTTGAGACTCTCTGCGATCT
CTACGAGACTCTAGCCATCACTCAGAGTGTCATCTTTGTCAACACTCGTCGCAAGGTCGACTGGCTCACAGACAAAATGA
GAAGCCGTGACCACACAGTCTCAGCAACTCATGGAGACATGGACCAAAACACCAGAGACATCATCATGAGAGAGTTCAGG
TCTGGCTCGTCTCGTGTTCTAATCACAACCGATCTCTTGGCTCGTGGTATCGATGTGCAGCAAGTCTCTCTAGTCATAAA
CTTTGACCTCCCAACTCAGCCAGAGAATTACCTTCACCGTATCGGAAGAAGTGGAAGGTTCGGGAGAAAGGGTGTGGCGA
TTAACTTTGTGACTCTTGATGATCAGAGAATGCTGTTTGATATTCAGAAATTCTACAATGTGGTTGTTGAGGAGCTTCCC
TCAAACGTGGCTGATTTGCTGTGAAGAAGAAGAAGAAGAAGAAGAAGAAAGGTTGCTTGTTTCGCAAATTTCTTATTTGA
TTTTTGACCCGTCTCTCTCTCTCTGAATCATCGATACATCTTTTTCATTCTCTAGTATTCTTCATCAACTCTATCGAACA
TATATATGTCTCTTCTGACCATATTTCTTTTTTATCAAATGCAATATTTATTTCTTCTCTTGTATGATCCAAAAATCTTT
CGTAATTACAAGTCTATTCACAGCAATTCTAT

1=============================Open Reading Frames===========================1632

 =========                                                                        +1
 ======= ==========================================================     =====     +2
           ========= ====================                    ========             +3
             ==================                                                   -3
                                                                                  -2
 ======                                            =======                        -1
        =============================================================             ESTScan(+)
                                                                                  
        =================================================================         framefinder(+)
________________________________________________________________________________

1===================================TC284366================================1632
        1         >                 72          >   <           90           
       2        >          71        >         76       >  <       126        
          3           >                       73            >   <     134      
           4           >          <       74          <          93          
              5               >                75           >   <    135     
           6           >                            77           >   <   141    
          7          >                   <        78          <       133       
           8            >                <        79             <    136    
                                       9                                       >
                                     10                                     >
    11     >                67            >        83     >      <     137      
           12            >                <       80             <    138    
          13           >                                81               >
         14          >                               82          >
          15          >                                 84         >
         16         >                           <             85             
       17a       >                                         86            >
..............................................            17b            >
              18               >                <             87             
           19           >                        <            88             
          20           >                         <            89             
         21          >                              <           91           
                                     22                                     >
              23a               >                   <           92           
.............................................................<      23b      
             24              >                        <          94          
          25a          >                              <          95          
........................................................<       25b        
             26              >                                 96        >
           27            >                             <         97          
           28           >                              <         98          
       29       >                                      <         99          
      30       >                                       <         100         
           31           >                               <        101         
           32           >                               <        102         
          33          >                                 <        103         
         34         >                                   <        104         
        35         >                                    <        105         
        36         >                                    <       106        
          37          >                                  <        107        
         38         >                                    <        108        
         39          >                                   <        109        
          40          >                                  <        110        
          41           >                                 <        111        
                                     42                                     >
        43        >                                      <        112        
       44        >                                       <        113        
       45        >                                       <        114        
        46        >                                      <        115        
             47              >                           <        116        
            48             >                             <        117        
          49          >                                   <       118        
           50           >                                 <       119        
         51         >                                     <         120         
          52         >                                    <       121        
         53        >                                      <       122        
           54           >                                 <       123        
          55          >                                   <       124        
         56         >                                     <       125        
         57         >                                      <       127       
                                     58                                     >
            59           >                                 <       128       
                 60                >                       <       129       
             61           >                                <       130       
        62       >                                          <        131        
       63     >                                             <      132       
              64          >                                       <    139     
                                    65                             >
                                    66                             >
                   68    >                                        <   140     
                                   69                  >
                                70               >

                                                                                                                                                              
 #   Src  EST Id              GB#           Clone/Protein   left  right Library/Protein name
                                                                                                                                                              
  1  I024 BP824457            BP824457      RAFL22-09-J23       1   397 RAFL19
  2  I024 BP831751            BP831751      RAFL22-90-B05       1   352 RAFL19
  3  I034 6641578             DR236240      1205753             1   476 CERES-AL46
  4  I034 154812              DR236244      121912              1   483 CERES-148
  5  I034 1973866             DR236246      406365              1   636 CERES-AN
  6  I034 957955              DR236250      155645              1   489 CERES-148
  7  I034 6640833             DR236273      1205008             1   457 CERES-AL46
  8  I034 140563              DR236278      108656              1   508 CERES-148
  9  ETG  NP366488            AF386923      AAK62368            1  1632 Eukaryotic Initiation Factor 4A-2 [Arabidopsis thaliana]
 10  I023 Ceres:3997                        Ceres:3997          2  1578 full-length cDNA from Ceres, Inc.
 11  I034 5744958             DR236237      1150756             2   254 CERES-AL46
 12  I034 137793              DR236243      105799              2   531 CERES-148
 13  I034 160423              DR236252      143037              2   482 CERES-148
 14  I034 6640313             DR236255      1204488             2   445 CERES-AL46
 15  I034 153581              DR236256      120648              2   477 CERES-148
 16  I034 4511940             DR236258      1019880             2   427 CERES-148
 17a I034 38797               DR236260      3997                2   366 CERES-148
 17b I034 100605              DR370648      3997              937  1508 CERES-148
 18  I034 11068383            DR236261      1347968             2   654 CERES-AN65
 19  I034 1134935             DR236265      256310              2   512 CERES-148
 20  I034 1135633             DR236268      257008              2   499 CERES-148
 21  I034 4502621             DR236276      1014165             2   456 CERES-148
 22  ETG  NP506196            AY087965      AAM65512            2  1578 eukaryotic translation initiation factor 4A, putative [Arabidopsis thaliana]
 23a I024 AV823120            AV823120      RAFL05-15-K12       3   667 RAFL5
 23b I024 AV784041            AV784041      RAFL05-15-K12    1237  1565 RAFL5
 24  I024 AV830075            AV830075      RAFL09-62-C10       3   604 RAFL9
 25a I024 AV831311            AV831311      RAFL09-88-C02       3   487 RAFL9
 25b I024 AV815819            AV815819      RAFL09-88-C02    1137  1540 RAFL9
 26  I024 AV832205            AV832205      RAFL11-06-B10       3   609 RAFL11
 27  I034 153693              DR236234      120762              4   530 CERES-148
 28  I034 162375              DR236236      144544              4   500 CERES-149
 29  I034 6631306             DR236239      1195481             4   356 CERES-AL45
 30  I034 68961               DR236247      34777               4   322 CERES-149
 31  I034 962811              DR236251      154327              4   509 CERES-148
 32  I034 158724              DR236254      126414              4   517 CERES-148
 33  I034 6631241             DR236257      1195416             4   475 CERES-AL45
 34  I034 6912582             DR236264      1332812             4   423 CERES-AS12
 35  I034 133637              DR236266      101513              4   411 CERES-149
 36  I034 1105375             DR236267      250741              4   416 CERES-148
 37  I034 955412              DR236269      151701              4   470 CERES-148
 38  I034 6627507             DR236271      1191682             4   425 CERES-AL45
 39  I034 6626205             DR236272      1190380             4   453 CERES-AL45
 40  I034 5788769             DR236275      1159948             4   469 CERES-AL45
 41  I034 955664              DR236277      151961              4   497 CERES-148
 42  ETG  NP503159            AF428462      AAL16231            4  1578 At1g54270/F20D21_52 [Arabidopsis thaliana]
 43  I024 BP837130            BP837130      RAFL22-19-E13       5   385 RAFL19
 44  I024 BP853143            BP853143      RAFL25-22-E21       5   377 RAFL21
 45  I024 BP827947            BP827947      RAFL22-77-D20       7   375 RAFL19
 46  I034 12844526            DR236238      1367432             7   386 CERES-AN65
 47  I034 12826906            DR236270      1362078             7   608 CERES-AN65
 48  I02A 79-E014993-035-003  CB264219      MPIZp2000M193Q      9   566 MPIZ-ADIS-035
 49  I034 6624243             DR236274      1188418             9   460 CERES-AL45
 50  I034 168219              DR236235      148264             14   515 CERES-148
 51  I034 71755               DR236241      37605              14   438 CERES-148
 52  I034 1081347             DR236279      231707             14   458 CERES-148
 53  I024 BP860516            BP860516      RAFL25-44-G11      15   398 RAFL21
 54  I034 1150138             DR236249      271513             15   511 CERES-148
 55  I034 63604               DR236248      29303              16   467 CERES-148
 56  I024 BP848676            BP848676      RAFL25-06-E11      17   422 RAFL21
 57  I024 BP867583            BP867583      RAFL21-81-I19      17   426 RAFL21
 58  ETG  NP031529            X65053        CAA46189           25  1575 eukaryotic translation  initiation factor 4A-2
 59  I034 139579              DR236259      107660             40   530 CERES-148
 60  I02A 59-E018437-019-009  CB254774      MPIZp768E159Q      48   725 MPIZ-ADIS-019
 61  I034 131127              DR236245      98956              48   543 CERES-148
 62  I024 BP826198            BP826198      RAFL22-71-C24      49   364 RAFL19
 63  I008 M73N12STM           BE529121      600038347R1        51   302 Arabidopsis developing seed
 64  I034 6641515             DR236242      1205690            87   543 CERES-AL46
 65  ETG  NP036254            AC005287      AAD25605          146  1384 Eukaryotic Initiation Factor 4A-2
 66  ETG  NP800747            BT008504      AAP37863          146  1384 At1g54270 [Arabidopsis thaliana]
 67  I006 AV563361            AV563361      SQ186a06F         322   884 Arabidopsis thaliana green siliques Columbia
 68  I008 M68G12STM           BE527373      600036244R1       323   533 Arabidopsis developing seed
 69  I034 11070664            DR236253      1350249           337  1134 CERES-AN65
 70  I034 11059955            DR236263      1339540           337  1024 CERES-AN65
 71  I024 BP815471            BP815471      RAFL22-38-P15     396   769 RAFL19
 72  I006 AV554415            AV554415      RZ90c07R          537   993 Arabidopsis thaliana roots Columbia
 73  I02A 57-E011179-013-009  CB259380      MPIZp770B169Q     685  1246 MPIZ-ADIS-013
 74  I008 179                 T03976        B48TP             703  1038 AT-NHC
 75  I003 AF162841            AF162841      AtGER9            753  1243 Arabidopsis thaliana germinating seeds
 76  I008 20642               N65602        240A14T7          836  1158 Lambda-PRL2
 77  I02A 75-E8975-008-017-E  CB262063      MPIZp767E2017Q    837  1337 MPIZ-ADIS-008
 78  I024 BP829598            BP829598      RAFL22-82-J02     843  1215 RAFL19
 79  I024 BP837567            BP837567      RAFL22-21-C19     844  1215 RAFL19
 80  I024 BP823044            BP823044      RAFL22-63-L20     848  1215 RAFL19
 81  I02B 26K21               CD532321                        859  1501 Arabidopsis Leaf Senescence Library
 82  I025 007H11              BU636563                        868  1343 Infected Arabidopsis Leaf
 83  I008 12704               R30099        165F20T7          961  1205 Lambda-PRL2
 84  I02B 28F15               CD532675                        971  1382 Arabidopsis Leaf Senescence Library
 85  I006 AV519141            AV519141      APD49d02F         980  1578 Arabidopsis thaliana aboveground organs two to six-week old
 86  I034 13813997            DR383660      1204890           980  1518 CERES-AL46
 87  I006 AV543613            AV543613      RZ203f03F         985  1563 Arabidopsis thaliana roots Columbia
 88  I006 AV539737            AV539737      RZ139a02F         990  1579 Arabidopsis thaliana roots Columbia
 89  I006 AV539901            AV539901      RZ141b12F        1003  1572 Arabidopsis thaliana roots Columbia
 90  I006 AV543572            AV543572      RZ202h12F        1060  1579 Arabidopsis thaliana roots Columbia
 91  I006 AV559498            AV559498      SQ118e02F        1060  1576 Arabidopsis thaliana green siliques Columbia
 92  I006 AV539896            AV539896      RZ141b06F        1070  1578 Arabidopsis thaliana roots Columbia
 93  I006 AV564007            AV564007      SQ197d05F        1093  1578 Arabidopsis thaliana green siliques Columbia
 94  I006 AV560535            AV560535      SQ136c08F        1095  1578 Arabidopsis thaliana green siliques Columbia
 95  I006 AV562307            AV562307      SQ167h09F        1095  1573 Arabidopsis thaliana green siliques Columbia
 96  I008 33056               AA721913      117F17T7         1117  1517 Lambda-PRL2
 97  I024 BP617231            BP617231      RAFL16-23-B16    1121  1576 RAFL16
 98  I006 AV560156            AV560156      SQ130b03F        1126  1578 Arabidopsis thaliana green siliques Columbia
 99  I024 BP593442            BP593442      RAFL15-22-C13    1126  1565 RAFL15
100  I024 BP641337            BP641337      RAFL19-54-O09    1130  1575 RAFL19
101  I024 BP592001            BP592001      RAFL15-16-L11    1134  1565 RAFL15
102  I024 BP633882            BP633882      RAFL17-32-G06    1140  1577 RAFL17
103  I024 BP585577            BP585577      RAFL15-03-B10    1143  1577 RAFL15
104  I024 BP656313            BP656313      RAFL19-25-I17    1146  1565 RAFL19
105  I024 BP620889            BP620889      RAFL16-39-C19    1150  1565 RAFL16
106  I024 AV811421            AV811421      RAFL09-68-A17    1152  1537 RAFL9
107  I024 BP618083            BP618083      RAFL16-26-M22    1155  1565 RAFL16
108  I024 BP597328            BP597328      RAFL15-38-N17    1156  1565 RAFL15
109  I024 BP664152            BP664152      RAFL21-50-L05    1156  1577 RAFL21
110  I024 BP640789            BP640789      RAFL19-52-P22    1159  1565 RAFL19
111  I024 BP602723            BP602723      RAFL16-55-L20    1161  1565 RAFL16
112  I024 AV815261            AV815261      RAFL09-86-A12    1166  1577 RAFL9
113  I024 BP618011            BP618011      RAFL16-26-I04    1166  1576 RAFL16
114  I024 BP669850            BP669850      RAFL21-32-O09    1167  1575 RAFL21
115  I024 AV809623            AV809623      RAFL09-60-G06    1169  1577 RAFL9
116  I024 BP646754            BP646754      RAFL19-73-D18    1170  1575 RAFL19
117  I024 BP646851            BP646851      RAFL19-73-I08    1171  1575 RAFL19
118  I024 BP646707            BP646707      RAFL19-73-B05    1173  1565 RAFL19
119  I024 AV812109            AV812109      RAFL09-71-E14    1177  1565 RAFL9
120  I024 BP593566            BP593566      RAFL15-22-K10    1179  1624 RAFL15
121  I024 BP651688            BP651688      RAFL19-90-D01    1179  1575 RAFL19
122  I024 BP599721            BP599721      RAFL16-08-G13    1180  1577 RAFL16
123  I024 BP650325            BP650325      RAFL19-84-A18    1181  1573 RAFL19
124  I006 AV532824            AV532824      FB050g03F        1183  1577 Arabidopsis thaliana flower buds Columbia
125  I006 AV559094            AV559094      SQ111b03F        1190  1573 Arabidopsis thaliana green siliques Columbia
126  I024 BP646361            BP646361      RAFL19-71-N22    1201  1581 RAFL19
127  I024 BP622632            BP622632      RAFL17-03-O11    1203  1565 RAFL17
128  I024 BP631119            BP631119      RAFL17-22-H04    1203  1565 RAFL17
129  I024 BP655049            BP655049      RAFL19-19-M23    1204  1565 RAFL19
130  I024 BP654784            BP654784      RAFL19-18-N09    1213  1565 RAFL19
131  I024 BP587826            BP587826      RAFL15-44-A17    1215  1624 RAFL15
132  I024 BP628868            BP628868      RAFL17-14-D15    1218  1577 RAFL17
133  I006 AV566405            AV566405      SQ242g08F        1265  1632 Arabidopsis thaliana green siliques Columbia
134  I006 AV565461            AV565461      SQ224e08F        1307  1618 Arabidopsis thaliana green siliques Columbia
135  I006 AV532058            AV532058      FB034h09F        1314  1578 Arabidopsis thaliana flower buds Columbia
136  I006 AV562169            AV562169      SQ165b10F        1316  1573 Arabidopsis thaliana green siliques Columbia
137  I006 AV563396            AV563396      SQ186f05F        1321  1624 Arabidopsis thaliana green siliques Columbia
138  I024 BP590493            BP590493      RAFL15-11-B04    1326  1565 RAFL15
139  I006 AV565386            AV565386      SQ223a09F        1345  1612 Arabidopsis thaliana green siliques Columbia
140  I00E ATTS0481            Z17997        TASG114          1352  1578 AC16H
141  I02B 27F23               CD530065                       1411  1623 Arabidopsis Leaf Senescence Library



Sequence source codes:

I025 Aalborg Universitet, Institut for bioteknologi
I00E Laboratoire de Biologie Moleculaire des Plantes   CNRS, Gigot Claude / L512
I008 Michigan State University, Dept. of Biochemistry & Molecular Biology
I006 Kazusa DNA Research Institute, The First Laboratory for Plant Gene Research
I003 Hokkaido University, Division of Applied Bioscience, Graduate School of Agriculture
I034 Ceres  Inc, 
I023 Inc., Ceres
I02B Cornell University, Department of Horticulture
I024 RIKEN Genomic Sciences Center, Plant Functional Genomics Research Group
I02A Max Planck Institute for Plant Breeding Research, ADIS DNA core facility at MPIZ
ETGB Expressed Transcripts from GenBank

TC sequence strand: coding strand

		Evidence for coding strand		Evidence for reverse complement		Inconclusive evidence
ESTs	5' ESTs	(used as +)	62	(used as -)	3	(5'/3' source not known)
	3' ESTs	(used as -)	57	(used as +)	5	(5'/3' source not known)
	total	119		8		11
Expressed transcripts		5		-
Predicted genes		1		-
Protein hits		5		-
Trimmed polyA/T		1		-

Tentative Annotation:
UP|IF4A2_ARATH (P41377) Eukaryotic initiation factor 4A-2 (ATP-dependent RNA helicase eIF4A-2) (eIF-4A-2) , complete 0

Clone links to other TCs:

EST	Orientation	Linked EST	Linked EST Orientation	Linked TC #
DR236260	5'	DR376298	3'	TC285978
DR236260	5'	DR342637	5'	TC285978

GO annotation

GO id	GO term	EC#	Type	GOpep link	%sim	%cov
GO:0005524	ATP binding	-	M	FB\|FBgn0001942	85	93
GO:0000339	RNA cap binding	-	M	FB\|FBgn0001942	85	93
GO:0008026	ATP-dependent helicase activity	-	M	TAIR\|gene:3434200	79	78
GO:0003743	translation initiation factor activity	-	M	GeneDB_Pfalciparum\|PFD1070w	79	70
GO:0003729	mRNA binding	-	M	GeneDB_Pfalciparum\|PF14_0655	85	81
GO:0003724	RNA helicase activity	-	M	FB\|FBgn0001942	85	93
GO:0004004	ATP-dependent RNA helicase activity	-	M	GeneDB_Pfalciparum\|PFD1070w	79	70
GO:0017116	single-stranded DNA-dependent ATP-dependent DNA helicase activity	-	M	FB\|FBgn0001942	85	93
GO:0008372	cellular component unknown	-	C	TAIR\|gene:3434200	79	78
GO:0005829	cytosol	-	C	FB\|FBgn0001942	85	93
GO:0005634	nucleus	-	C	FB\|FBgn0001942	85	93
GO:0009505	cell wall (sensu Magnoliophyta)	-	C	TAIR\|gene:2030284	96	93
GO:0016281	eukaryotic translation initiation factor 4F complex	-	C	GeneDB_Pfalciparum\|PFD1070w	79	70
GO:0000381	regulation of alternative nuclear mRNA splicing, via spliceosome	-	B	FB\|FBgn0001942	85	93
GO:0006268	DNA unwinding during replication	-	B	FB\|FBgn0001942	85	93
GO:0000004	biological process unknown	-	B	TAIR\|gene:2030284	96	93
GO:0006441	binding to mRNA cap	-	B	GeneDB_Pfalciparum\|PF14_0655	85	81
GO:0007446	imaginal disc growth	-	B	FB\|FBgn0001942	85	93
GO:0006413	translational initiation	-	B	FB\|FBgn0001942	85	93
GO:0006446	regulation of translational initiation	-	B	GeneDB_Pfalciparum\|PFD1070w	79	70
GO:0002168	larval development (sensu Insecta)	-	B	FB\|FBgn0001942	85	93

Linking to Metabolic Pathways in KEGG

EC 3.6.1.-:

Starch and sucrose metabolism
Lipopolysaccharide biosynthesis
Folate biosynthesis

Referenced by :

Tentative Ortholog Group 1006353 (general group)

Tentative Ortholog Group 1170218 (general group)

Tentative Ortholog Group 966247 (general group)

Tentative Ortholog Group 967143 (general group)

Tentative Ortholog Group 967220 (general group)

Tentative Ortholog Group 967931 (general group)

Tentative Ortholog Group 970387 (general group)

Tentative Ortholog Group 973977 (general group)

Tentative Ortholog Group 982555 (general group)

Tentative Ortholog Group 983092 (general group)

Tentative Ortholog Group 989360 (general group)

Maps to :

Genome	Chromosome	End5	End3	Score
Arabidopsis genome	chr1	20,263,486	20,265,933	1612
Rice genome	chr6	29,459,144	29,461,187	610
Rice genome	chr2	2,558,783	2,560,983	580
Mouse genome	chr11	69,483,828	69,485,625	101
Rhesus macaque genome	chr17	39,743,301	39,744,928	58
Chimp genome	chr17	2,582,235	2,583,864	42

Comments and suggestions : Contact Us

Acknowledgements
	The Gene Index Project is supported in part by funding from the US National Science Foundation through grant #DBI-0552416.

Home

GCOD

Resourcerer

Gene Indices

Genomic Maps

EGO

**The DFCI Arabidopsis thaliana Gene Index (AtGI)**

AtGI TC Report:

EST IDs are linked to AtGI EST reports. ET# s are linked to qcGene reports. GB#s are linked to GenBank accessions.

TC sequence strand: coding strand

Home

GCOD

Resourcerer

Gene Indices

Genomic Maps

EGO

The DFCI Arabidopsis thaliana Gene Index (AtGI) AtGI TC Report: EST IDs are linked to AtGI EST reports. ET# s are linked to qcGene reports. GB#s are linked to GenBank accessions.

TC sequence strand: coding strand

**The DFCI Arabidopsis thaliana Gene Index (AtGI)**

AtGI TC Report:

EST IDs are linked to AtGI EST reports. ET# s are linked to qcGene reports. GB#s are linked to GenBank accessions.